Egr1 chip
WebMar 21, 2024 · EGR1 (Early Growth Response 1) is a Protein Coding gene. Diseases associated with EGR1 include Ischemia and Monocytic Leukemia. Among its related … WebJan 24, 2012 · Consistent with the ChIP results seen in Figure 3, Elk-1 did not significantly affect the activity of the EGR1-luc promoter in LNCaP cells (data not shown). These differences between cell lines in response to exogenous Elk-1 may be due to high endogenous levels of Elk-1 in LNCaP cells, as we observed that the −771 hEGR1-luc …
Egr1 chip
Did you know?
WebThe Township of Fawn Creek is located in Montgomery County, Kansas, United States. The place is catalogued as Civil by the U.S. Board on Geographic Names and its elevation … WebAll lanes : Anti-Egr1 antibody [EPR23981-203] - ChIP Grade at 1/1000 dilution Lane 1 : Untreated PC-12 (rat adrenal gland pheochromocytoma cell) whole cell lysate 20 µg …
WebAll lanes : Anti-Egr1 antibody [EPR23981-203] - ChIP Grade (ab307199) at 1/1000 dilution Lane 1 : Untreated PC-12 (rat adrenal gland pheochromocytoma cell) whole cell lysate … WebEGR1: A gene on chromosome 5q31.1 that encodes a DNA-binding nuclear protein of the EGR family of C2H2-type zinc-finger transcriptional regulators. EGR1 activates the …
WebRecombinant Anti-Egr1 antibody [EPR23981-203] - ChIP Grade – BSA and Azide free (ab307200) Datasheet Certificate of Compliance Submit a review +2 Key features and details Produced recombinantly (animal-free) for high batch-to-batch consistency and long term security of supply WebTranscription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed into RNA molecules that can encode proteins are said to produce messenger RNA (mRNA). Other segments of DNA …
WebOct 15, 2024 · H, ChIP-PCR assay showed that EGR1 directly interacted with the EGR1 binding sites within HNF1A-AS1 promoter in MKN-45 cells and BGC-823 cells. A specific strong band of the expected size was detected in the input DNA. The fragment containing the EGR1 binding sites was detected. No band or very weak band was detected in the …
WebAug 28, 2024 · Correlation between ChIP-seq and RNA-seq data and EGR1 induction by serum and/or nutrient deprivation was determined using an ordinary one-way ANOVA with Dunnett’s post-test. Starvation-induced changes of autophagy-associated genes, the POLR2 signal for key autophagy genes, and EGR1 knockdown, knockout, and overexpression … earthworm bristles crosswordWebDec 15, 2024 · EGR1 (early growth response 1), also known as NGFI-A, KROX-24, ZIF268, and TIS8, is a member of the early growth response (EGR) family. The expression of EGR1 is stimulated by many extracellular signaling molecules, including hormones, neurotransmitters, growth and differentiation factors, and cytotoxic metabolites [ 6 ]. earthworm breathes through itsWebFeb 3, 2024 · Fig. 5: EGR1 is recruited to the MIF promoter in trTET2-mutant CMML monocytes. a Quantitative ChIP-PCR analyses of MIF promoter (R3) were performed in … earthworm belongs to which phylumWebIncreased EGR1 expression activates transcription of other signaling molecules, including CDK5 and tyrosine hydroxylase, and exerts long term effects on neural cell growth and differentiation (2,3). O'Donovan, K.J. et al. (1999) Trends Neurosci. 22, 167-173. Harada, T. et al. (2001) Nat. Cell Biol. 3, 453-459. earthworm anatomy videoWebJan 11, 2024 · The Egr family comprises five members—Egr1-4 and Wilms Tumor 1 (WT1)—which share highly homologous DNA-binding domains at their C-termini composed of three zinc finger motifs that bind similar GC-rich, … ct scan frequency safeWebInformation for Egr1(Zf)/K562-Egr1-ChIP-Seq(GSE32465)/Homer (Motif 79) CAGTTCAGGATCACTGACGTCTAGACTGACTGGACTCTAG Reverse … ct scan friscoWebSep 15, 2024 · To find target genes of Egr1, we performed ChIP-seq for Egr1 in mouse NSCs at 24 h after Egr1 transduction (Fig. 5C) and identified 3,884 Egr1-occupied loci using input DNA as Ctrl (Fig. 5J). We confirmed that the most enriched motif in these loci was Egr1 ( Fig. 5 K ), and that Egr1 occupied the region around the TSS of a known Egr1 … earthworm breathe through which organ